Dharmafect sirna
Webamount of siRNA at 20 nM/well but varied the amount of transfection reagents by ±25% of the dose recommended by the manufacturers. For example, Dharmacon recommended 0.8 µl/well DharmaFECT 3 transfection reagent for macro-phages seeded in a 12-well plate. Therefore, 20 nM Bax siRNA was transfected with 0.6 µl, 0.8 µl, or 1.0 µl/well … WebFeb 15, 2007 · DharmaFECT® 1 siRNA transfection reagent is specifically formulated for the following cell lines: A549, HEK293, HeLa, HeLa 53, MCF7, DU 145, HUVEC, SKBR3 …
Dharmafect sirna
Did you know?
WebI have used Dharmafect I successfully in megakaryocytic cells. I highly recommend it for use with naked siRNA. To keep costs down, you can use the same concentration of Dharmafect for a...
WebDharmaFECT® Duo is a lipid-based reagent specially formulated for co-transfection of plasmid and siRNA. Under optimized conditions, efficient delivery of both plasmid and siRNA can be achieved with minimal cell toxicity. As is generally observed with plasmid transfection, cell viability is reduced compared to siRNA transfection alone. WebDharmaFECT 1 is the most all-purpose transfection reagent, demonstrating efficient, low-toxicity delivery to over 80% of validated cell types. DharmaFECT 2, 3, and 4 offer …
WebWhile GenMute™ and Dharmafect™ 4 reagents delivered significant gene silencing from 1.0 nM of renilla luciferase siRNA, li pofectamine™ 2000 gave good knockdown only after 30 nM (data not shown). WebNov 9, 2016 · Cells were transfected with 100 nM siRNA against SCD1 (SMARTpool reagent; Dharmacon, Chicago, IL, USA) or control siRNA (nontargeting siRNA; Dharmacon) using DharmaFECT 4 transfection reagent (Dharmacon), and incubated for 24 h in 0.2% FCS-containing DMEM. Following transfection, the cells were starved for 24 h, treated …
WebDharmaFECT 1 is our most all-purpose transfection reagent formulation; demonstrating efficient, low-toxicity delivery to over 35 cell types. DharmaFECT 1 achieves effective …
WebNov 12, 2012 · This is vastly superior to a commercially available control, DharmaFECT, which resulted in only ~60% siRNA positive MSCs. Moreover, the diblock copolymer, at conditions that result in excellent knockdown (down to ~10% of control gene expression), was cytocompatible, causing no negative effects on MSC survivability. twint teamWebMar 6, 2024 · Beads were washed, pellets were resuspended Laemmlisample buffer, sampleswere boiled SDS-PAGE.siRNA Transfection GlioblastomaCells—Cells grown 80%confluency were transfected controlscrambled siRNAor siRNAtargeting Rap1Aor PLD1 using DharmaFect transfectionreagent (Dharmacon, Lafayette, CO) per … takada collectionWebApr 15, 2014 · The use of DharmaFECT 2 and DharmaFECT 4 resulted in siRNA up-take by a high proportion of bMDM, but caused considerable cell toxicity. The remaining … takada collection face bankWebLung cancer cells were transfected with USP14 siRNA (siUSP14#1 and siUSP14#2) or nonspecific siRNA (siNC) (all from Shanghai GenePharma Co., Ltd, China) using DharmaFECT one siRNA infection reagent (Thermo Fisher Scientific). The siRNA sequences were: siUSP14#1: GACAGAAAGUUAUGGUGAAAG; siUSP14#2: … twint support prepaidWebMaterials required for use of RTF siRNA Libraries. 96-well RTF siRNA Library plates, containing 6.25 pmol of SMARTpool siRNA reagent per well (triplicate experiment recommended) DharmaFECT transfection reagent, or other optimized transfection reagent (sold separately) Serum-free and antibiotic-free cell culture medium such as MEM-RS, takacs university of iowaWebCell line Cell type Recommended DharmaFECT formulation DharmaFECT volume/well (µL)Plating density Other successful formulations Rodent A7R5 Rat aortic smooth muscle 2 0.1 5 x 103 1 C2C12 Mouse ... twint support telefonnummerWebApr 9, 2024 · The siRNA transfections were performed in 24-well culture plates with Raw 264.7 cells in the presence of DharmaFECT Transfection Reagent 1 (Horizon Discovery, Waterbeach, UK). siRNA (5 nmol) and 2.0 μL of TransFectin reagent were added to each well, adding α-MEM to a final volume of 500 μL, and the cells were cultured for 24 h. twinttax